ID: 1050017718_1050017720

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1050017718 1050017720
Species Human (GRCh38) Human (GRCh38)
Location 9:1252652-1252674 9:1252666-1252688
Sequence CCATGTGGTATTGTGGAATTTAT GGAATTTATGCTAGGCTTGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 5, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!