ID: 1050101279_1050101280

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1050101279 1050101280
Species Human (GRCh38) Human (GRCh38)
Location 9:2122747-2122769 9:2122764-2122786
Sequence CCAAAGGAAGAAGGAAAAGGTAA AGGTAAATAACAATGATTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 126, 4: 989} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!