ID: 1050145091_1050145093

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1050145091 1050145093
Species Human (GRCh38) Human (GRCh38)
Location 9:2559322-2559344 9:2559343-2559365
Sequence CCTGGCAGCAGCCGTGTAGCACA CAAAAAGAGAATATGTGTGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!