ID: 1050211750_1050211758

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1050211750 1050211758
Species Human (GRCh38) Human (GRCh38)
Location 9:3267245-3267267 9:3267278-3267300
Sequence CCTGAAGCACCCACAACATAAAA TAGGTTCTCTATAATGGGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 209} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!