ID: 1050480414_1050480419

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1050480414 1050480419
Species Human (GRCh38) Human (GRCh38)
Location 9:6081920-6081942 9:6081941-6081963
Sequence CCTCTTTTATTTTGAGTCCCACC CCAGGAGCCCTTGATAAATTTGG
Strand - +
Off-target summary No data {0: 12, 1: 7, 2: 2, 3: 10, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!