ID: 1050552981_1050552984

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1050552981 1050552984
Species Human (GRCh38) Human (GRCh38)
Location 9:6763588-6763610 9:6763630-6763652
Sequence CCTTTGTGTTTATGTGCATTTTC CAGTGTTACCATTGTGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 32, 3: 212, 4: 736} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!