ID: 1050601584_1050601593

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1050601584 1050601593
Species Human (GRCh38) Human (GRCh38)
Location 9:7258281-7258303 9:7258332-7258354
Sequence CCCAAAGTGCTGGGATTACAGGC TTCTTAAAGCTACAGATGGGAGG
Strand - +
Off-target summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!