ID: 1050601585_1050601593

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1050601585 1050601593
Species Human (GRCh38) Human (GRCh38)
Location 9:7258282-7258304 9:7258332-7258354
Sequence CCAAAGTGCTGGGATTACAGGCA TTCTTAAAGCTACAGATGGGAGG
Strand - +
Off-target summary {0: 89533, 1: 228199, 2: 240322, 3: 214910, 4: 187714} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!