ID: 1050718027_1050718028

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1050718027 1050718028
Species Human (GRCh38) Human (GRCh38)
Location 9:8552363-8552385 9:8552384-8552406
Sequence CCAGCGTGAGAGAGTTTTTGACA CAGAGTATGACATGTGTTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!