ID: 1050742728_1050742733

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1050742728 1050742733
Species Human (GRCh38) Human (GRCh38)
Location 9:8841035-8841057 9:8841078-8841100
Sequence CCATGGCTACAGAGTGGTGAGGA TCTTTCTGGGGTAAAATGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 214} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!