ID: 1050784252_1050784257

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1050784252 1050784257
Species Human (GRCh38) Human (GRCh38)
Location 9:9379565-9379587 9:9379603-9379625
Sequence CCATAAATTAACCTTCTGAAATT TTGAATCTACAGATGAAGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 499} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!