ID: 1050784255_1050784257

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1050784255 1050784257
Species Human (GRCh38) Human (GRCh38)
Location 9:9379576-9379598 9:9379603-9379625
Sequence CCTTCTGAAATTTTGATTGGGAT TTGAATCTACAGATGAAGTTGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 44, 3: 213, 4: 683} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!