ID: 1050841820_1050841821

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1050841820 1050841821
Species Human (GRCh38) Human (GRCh38)
Location 9:10158963-10158985 9:10158979-10159001
Sequence CCAAGTCAGAGTGGCTGTTCAGC GTTCAGCAGCACCATGTTGTAGG
Strand - +
Off-target summary {0: 4, 1: 25, 2: 67, 3: 67, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!