ID: 1050868213_1050868220

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1050868213 1050868220
Species Human (GRCh38) Human (GRCh38)
Location 9:10531345-10531367 9:10531384-10531406
Sequence CCTAAAAATCACCATACTATGCA ACATAGGGATGATGGGGAAATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 9, 3: 33, 4: 234} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!