ID: 1050964579_1050964581

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1050964579 1050964581
Species Human (GRCh38) Human (GRCh38)
Location 9:11782639-11782661 9:11782678-11782700
Sequence CCTGAGATGGGATAATTTATAAA GACTCACTGTACCACATGACTGG
Strand - +
Off-target summary {0: 7, 1: 102, 2: 1244, 3: 9212, 4: 15447} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!