ID: 1051108178_1051108180

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1051108178 1051108180
Species Human (GRCh38) Human (GRCh38)
Location 9:13604208-13604230 9:13604258-13604280
Sequence CCAGTATTCTTTCTTGGATGATC ATTTTGGTTCTTAGTGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 49, 4: 626}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!