ID: 1051142669_1051142670

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1051142669 1051142670
Species Human (GRCh38) Human (GRCh38)
Location 9:13994663-13994685 9:13994693-13994715
Sequence CCATGCTTTGGGATTGGATGAAC AAGCATTTTTTGCATCCTGCTGG
Strand - +
Off-target summary No data {0: 2, 1: 97, 2: 91, 3: 71, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!