ID: 1051195102_1051195107

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1051195102 1051195107
Species Human (GRCh38) Human (GRCh38)
Location 9:14555644-14555666 9:14555657-14555679
Sequence CCCTCCAGGAAGTGATAACTGAA GATAACTGAATTGTCCAAAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!