ID: 1051209088_1051209095

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1051209088 1051209095
Species Human (GRCh38) Human (GRCh38)
Location 9:14722562-14722584 9:14722614-14722636
Sequence CCTTGGCAGGAGTACGGGGGAAA TGCCGTGTGGTCTTTCCTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 218} {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!