ID: 1051272089_1051272104

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1051272089 1051272104
Species Human (GRCh38) Human (GRCh38)
Location 9:15365523-15365545 9:15365576-15365598
Sequence CCCAGAAGCCCAGCCAGCTTCAC CAGGTGGATCACCTGAGGTCGGG
Strand - +
Off-target summary {0: 105, 1: 172, 2: 334, 3: 296, 4: 723} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!