ID: 1051272098_1051272106

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1051272098 1051272106
Species Human (GRCh38) Human (GRCh38)
Location 9:15365554-15365576 9:15365578-15365600
Sequence CCAGCACTTTGGGAGGCCGATGC GGTGGATCACCTGAGGTCGGGGG
Strand - +
Off-target summary {0: 347, 1: 85653, 2: 217333, 3: 227469, 4: 149149} {0: 57, 1: 1134, 2: 1926, 3: 2411, 4: 2916}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!