ID: 1051272098_1051272109

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1051272098 1051272109
Species Human (GRCh38) Human (GRCh38)
Location 9:15365554-15365576 9:15365604-15365626
Sequence CCAGCACTTTGGGAGGCCGATGC CAAGACCAGCCTGACCAACATGG
Strand - +
Off-target summary {0: 347, 1: 85653, 2: 217333, 3: 227469, 4: 149149} {0: 10734, 1: 66234, 2: 131886, 3: 161016, 4: 155050}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!