ID: 1051292597_1051292605

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1051292597 1051292605
Species Human (GRCh38) Human (GRCh38)
Location 9:15560254-15560276 9:15560296-15560318
Sequence CCTGAATTTGAATGTTGGCCTGC TCTCCTGGATGATATCCTGAAGG
Strand - +
Off-target summary {0: 2540, 1: 4160, 2: 3571, 3: 1384, 4: 798} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!