ID: 1051556265_1051556272

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1051556265 1051556272
Species Human (GRCh38) Human (GRCh38)
Location 9:18385823-18385845 9:18385853-18385875
Sequence CCAAACTAGCAACACATGGTGCA AGTTATAGGCAGTGGGTGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!