ID: 1051741583_1051741588

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1051741583 1051741588
Species Human (GRCh38) Human (GRCh38)
Location 9:20257808-20257830 9:20257822-20257844
Sequence CCATCCCCTGAGCCTCTGGTTTT TCTGGTTTTTCTAAAACGAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!