ID: 1051820988_1051820992

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1051820988 1051820992
Species Human (GRCh38) Human (GRCh38)
Location 9:21168069-21168091 9:21168086-21168108
Sequence CCTCTGCCCTATAGATACTGAGT CTGAGTCCTTAAATGGAATGAGG
Strand - +
Off-target summary No data {0: 4, 1: 1, 2: 0, 3: 16, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!