ID: 1051822270_1051822283

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1051822270 1051822283
Species Human (GRCh38) Human (GRCh38)
Location 9:21181712-21181734 9:21181756-21181778
Sequence CCAGTCTGTCTCCCATTGGTCAA AGGCAGGGAACCCCTGTCTTGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 2, 3: 17, 4: 171} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!