ID: 1051822273_1051822283

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1051822273 1051822283
Species Human (GRCh38) Human (GRCh38)
Location 9:21181735-21181757 9:21181756-21181778
Sequence CCACCCACCCGTCACATCACCAG AGGCAGGGAACCCCTGTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 237} {0: 3, 1: 4, 2: 27, 3: 67, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!