ID: 1051840839_1051840844

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1051840839 1051840844
Species Human (GRCh38) Human (GRCh38)
Location 9:21396216-21396238 9:21396229-21396251
Sequence CCACTCTGCGGACCCCAAGCGCG CCCAAGCGCGGGTCTCCTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50} {0: 1, 1: 0, 2: 1, 3: 3, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!