ID: 1052025770_1052025772

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1052025770 1052025772
Species Human (GRCh38) Human (GRCh38)
Location 9:23571685-23571707 9:23571700-23571722
Sequence CCAGGTTTTGGTCAGGAGACAAA GAGACAAAATATAATAGCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 27, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!