ID: 1052037466_1052037469

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1052037466 1052037469
Species Human (GRCh38) Human (GRCh38)
Location 9:23699019-23699041 9:23699056-23699078
Sequence CCTTACAACTGACAATCTCTTAT ATGTCTTTCTATAGGAGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!