ID: 1052056222_1052056225

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1052056222 1052056225
Species Human (GRCh38) Human (GRCh38)
Location 9:23910724-23910746 9:23910766-23910788
Sequence CCGTGAGTTCAAGGCTGTATTGT ATAGCCACTGCATTCTAGCCTGG
Strand - +
Off-target summary No data {0: 10, 1: 171, 2: 905, 3: 4564, 4: 39795}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!