ID: 1052056222_1052056227

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1052056222 1052056227
Species Human (GRCh38) Human (GRCh38)
Location 9:23910724-23910746 9:23910768-23910790
Sequence CCGTGAGTTCAAGGCTGTATTGT AGCCACTGCATTCTAGCCTGGGG
Strand - +
Off-target summary No data {0: 3, 1: 35, 2: 571, 3: 5402, 4: 7480}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!