ID: 1052056223_1052056226

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1052056223 1052056226
Species Human (GRCh38) Human (GRCh38)
Location 9:23910747-23910769 9:23910767-23910789
Sequence CCTACCATCATGCTTGTGAATAG TAGCCACTGCATTCTAGCCTGGG
Strand - +
Off-target summary No data {0: 11, 1: 224, 2: 2634, 3: 30756, 4: 209462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!