ID: 1052294135_1052294137

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1052294135 1052294137
Species Human (GRCh38) Human (GRCh38)
Location 9:26878776-26878798 9:26878823-26878845
Sequence CCGTACTCCAGCTTGGGGGACAG AAAATCCAACGCTTTCCTCTAGG
Strand - +
Off-target summary {0: 3, 1: 26, 2: 638, 3: 5195, 4: 6903} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!