ID: 1052335249_1052335257

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1052335249 1052335257
Species Human (GRCh38) Human (GRCh38)
Location 9:27312590-27312612 9:27312643-27312665
Sequence CCCTCAATGGACGACTACAAAAA GCACGGTGCTTGGCACAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 530} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!