ID: 1052378222_1052378231

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1052378222 1052378231
Species Human (GRCh38) Human (GRCh38)
Location 9:27741671-27741693 9:27741712-27741734
Sequence CCCTGCTTGGTGAGGAAATACGG CAGTCTGGCCACTTTTCTGTAGG
Strand - +
Off-target summary No data {0: 23, 1: 57, 2: 122, 3: 223, 4: 662}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!