ID: 1052442999_1052443007

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1052442999 1052443007
Species Human (GRCh38) Human (GRCh38)
Location 9:28521933-28521955 9:28521970-28521992
Sequence CCACCACAAGCTAGAAGAAGCAA CTGTATCCATCGAGGGAGCATGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 82, 3: 402, 4: 1090} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!