ID: 1052748759_1052748768

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1052748759 1052748768
Species Human (GRCh38) Human (GRCh38)
Location 9:32467427-32467449 9:32467470-32467492
Sequence CCTTCTTGAATACAGGGGGCCCT TGAAAGGTTTACATGTTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 95} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!