ID: 1052809491_1052809498

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1052809491 1052809498
Species Human (GRCh38) Human (GRCh38)
Location 9:33044541-33044563 9:33044554-33044576
Sequence CCCCAGCCTTCAATGCTGGAGGG TGCTGGAGGGACGGCCGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 248} {0: 1, 1: 0, 2: 1, 3: 18, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!