ID: 1052936804_1052936814

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1052936804 1052936814
Species Human (GRCh38) Human (GRCh38)
Location 9:34099983-34100005 9:34100034-34100056
Sequence CCCTCTAGAGCAGTGGTACTTAA TCTCTCTTTTTTTAGAGACAGGG
Strand - +
Off-target summary No data {0: 6, 1: 62, 2: 546, 3: 4378, 4: 34677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!