ID: 1052936807_1052936819

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1052936807 1052936819
Species Human (GRCh38) Human (GRCh38)
Location 9:34100006-34100028 9:34100054-34100076
Sequence CCTTTTTTGAGCCTTGGACCCCC GGGTCTCACTTTGGGGCCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 43, 3: 460, 4: 1743}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!