ID: 1053002455_1053002461

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1053002455 1053002461
Species Human (GRCh38) Human (GRCh38)
Location 9:34584822-34584844 9:34584836-34584858
Sequence CCCCAGCCTCCTCTGGTCCAGAC GGTCCAGACCTTTCCAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 404} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!