ID: 1053002456_1053002461

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1053002456 1053002461
Species Human (GRCh38) Human (GRCh38)
Location 9:34584823-34584845 9:34584836-34584858
Sequence CCCAGCCTCCTCTGGTCCAGACC GGTCCAGACCTTTCCAAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!