ID: 1053079057_1053079070

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1053079057 1053079070
Species Human (GRCh38) Human (GRCh38)
Location 9:35159573-35159595 9:35159622-35159644
Sequence CCACCAGGCCCGGCTAATCTTGA CCTCAGCCTCCCAAAGTGCTGGG
Strand - +
Off-target summary No data {0: 90349, 1: 212695, 2: 235979, 3: 260133, 4: 296590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!