ID: 1053168940_1053168949

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1053168940 1053168949
Species Human (GRCh38) Human (GRCh38)
Location 9:35864763-35864785 9:35864796-35864818
Sequence CCTTACCTCTCACCTACTGGCCA GTCTGTAGGGAGCTGGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 215} {0: 1, 1: 0, 2: 1, 3: 23, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!