ID: 1053305307_1053305314

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1053305307 1053305314
Species Human (GRCh38) Human (GRCh38)
Location 9:36980596-36980618 9:36980646-36980668
Sequence CCAGACACAGAAGGGTTGGGGGA CAGTGTAGAGACCCTGTTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 262} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!