ID: 1053397139_1053397144

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1053397139 1053397144
Species Human (GRCh38) Human (GRCh38)
Location 9:37785327-37785349 9:37785376-37785398
Sequence CCGGTCGCATCGTGGGGATACGA GATCTCTGGAAGCTGAGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 24} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!