ID: 1053480962_1053480972

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1053480962 1053480972
Species Human (GRCh38) Human (GRCh38)
Location 9:38415883-38415905 9:38415918-38415940
Sequence CCCTCTATCTGATCCACCCACTC CCATCTGAGGGCCCTCTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 220} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!