ID: 1053667176_1053667183

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1053667176 1053667183
Species Human (GRCh38) Human (GRCh38)
Location 9:40324519-40324541 9:40324570-40324592
Sequence CCTGTCTCACCAGAGCACTCTTC AGGGAGTCCCATTTCAGGTGTGG
Strand - +
Off-target summary {0: 6, 1: 2, 2: 5, 3: 17, 4: 199} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!